Chapter 19: Rolling Hash & Rabin-Karp (String Algorithms)

Chapter 19: Rolling Hash & Rabin-Karp (String Algorithms) ​

Why? ​

Rolling Hash and Rabin-Karp are powerful hashing techniques for efficient string matching, especially when dealing with:

  • Substring search (e.g., checking if a pattern exists in a text).
  • Detecting repeated sequences (e.g., plagiarism detection, bioinformatics).
  • Finding anagrams or scrambled substrings efficiently.

Traditional brute-force substring search takes O(N × M) time (where N is text length, M is pattern length).

Rolling Hash reduces this to O(N) on average using a sliding window hash function.

Core Idea ​

Rolling Hash (Sliding Window Hashing) ​

Instead of recomputing the entire hash for each substring, Rolling Hash efficiently updates it in O(1) time when sliding the window.

For a string S of length N and a window of size M:

  • Compute the initial hash of S[:M].
  • Slide the window: Remove the left character, add the right character, and compute the new hash efficiently.

Hash formula for a base B and prime P:

\text{Hash} = (B \times \text{previous_hash} - \text{outgoing_char} \times B^M + \text{incoming_char}) \mod P

Rabin-Karp Algorithm (Pattern Matching) ​

Uses rolling hash for fast substring matching:

  1. Compute the hash of the pattern.
  2. Compute the hash of each window in the text.
  3. If hashes match, compare characters to confirm (to avoid false positives).
  4. Slide the window and update the hash in O(1).

Example Problems and Solutions ​

1. Repeated DNA Sequences (Medium) ​

Problem: Given a DNA sequence s, find all 10-letter-long substrings that appear more than once.

Approach:

  • Use rolling hash (or set-based lookup) to detect duplicate substrings efficiently.

Python Solution (Rolling Hash)

python
def findRepeatedDnaSequences(s):
    if len(s) < 10:
        return []

    seen = set()
    repeated = set()
    base = 4  # Since DNA has 4 characters (A, C, G, T)
    prime = 10**9 + 7
    hash_val = 0
    B_M = pow(base, 9, prime)  # Base^M-1 for rolling hash

    char_map = {'A': 0, 'C': 1, 'G': 2, 'T': 3}

    for i in range(len(s)):
        hash_val = (hash_val * base + char_map[s[i]]) % prime

        if i >= 9:  # When we have a valid 10-char window
            if hash_val in seen:
                repeated.add(s[i-9:i+1])
            seen.add(hash_val)

            # Remove leftmost char from hash (rolling hash update)
            hash_val = (hash_val - char_map[s[i-9]] * B_M) % prime

    return list(repeated)

# Example
s = "AAAAACCCCCAAAAACCCCCCAAAAAGGGTTT"
print(findRepeatedDnaSequences(s))  # Output: ["AAAAACCCCC", "CCCCCAAAAA"]

✅ O(N) complexity, much faster than O(N²) brute force.

✅ Memory-efficient hashing instead of storing all substrings.

⚠️ Potential hash collisions (rare but possible).

2. Substring with Concatenation of All Words (Hard) ​

Problem: Given a string s and a list of words (all of same length), find all starting indices of substrings in s that are concatenations of all words in any order.

Approach:

  • Each window contains a permutation of the words.
  • Rolling hash + sliding window for fast checking.

Python Solution (HashMap + Sliding Window)

python
from collections import Counter

def findSubstring(s, words):
    if not s or not words:
        return []

    word_len = len(words[0])
    word_count = len(words)
    total_len = word_len * word_count
    word_map = Counter(words)
    result = []

    for i in range(word_len):  # Try all possible start positions
        left, right = i, i
        current_map = Counter()

        while right + word_len <= len(s):
            word = s[right:right + word_len]
            right += word_len

            if word in word_map:
                current_map[word] += 1
                while current_map[word] > word_map[word]:  # Too many instances of a word
                    current_map[s[left:left + word_len]] -= 1
                    left += word_len
                if right - left == total_len:  # Valid window
                    result.append(left)
            else:  # Invalid word, reset window
                current_map.clear()
                left = right

    return result

# Example
s = "barfoothefoobarman"
words = ["foo", "bar"]
print(findSubstring(s, words))  # Output: [0, 9]

✅ Sliding window avoids unnecessary recomputation.

✅ Efficient O(N) solution compared to brute-force O(N × M!).

⚠️ Does not use rolling hash (word-based hashmap instead).

When to Use Rolling Hash vs. Other String Matching Algorithms ​

AlgorithmBest Use CaseTime ComplexityNotes
Brute Force (O(N × M))Short pattern matchingO(N × M)Slow for large inputs
KMP (Knuth-Morris-Pratt)Exact pattern matchingO(N + M)Good when no hash needed
Rabin-Karp (Rolling Hash)Multiple pattern matchingO(N) (avg)Fast for large texts
Aho-Corasick (Trie + BFS)Multi-pattern matchingO(N + M)Works for dictionary-based lookups

Conclusion ​

  • Rolling Hash is an efficient O(N) technique for substring matching (vs. O(N × M) brute force).
  • Rabin-Karp extends Rolling Hash for pattern matching with quick hash comparisons.
  • Useful for detecting duplicates, plagiarism detection, DNA sequence analysis, and anagram search.
  • Alternative string algorithms (KMP, Aho-Corasick) are better for certain problems.